Starchild Skull - Video

Disclaimer: This has been made a thread of before on ATS - but after seeing this thread, Photographic Evidence of an Alternative History - I felt it was important to share with those who have not heard of this before.

The starchild skull came into the possession of Lloyd Pye in February 1999 , the skull was found around 1930 in a mine tunnel about 100 miles (160 km) southwest of Chihuahua, Mexico, buried alongside a normal human skeleton that was exposed and lying supine on the surface of the tunnel.

Possibly the strangest looking skull ever discovered. Part of the skull's DNA is not human. Through carbon dating, researchers have found that the skull is approximately over 900 years old. It has over two dozen major physiological differences to that of a human.



Thought this video would be enjoyed by many here on ATS.



Cheers.

I have always felt that the Starchild skull was not human. And this video has just pretty much confirmed that hunch. Its a very mysterious thing from the look of it right the way down to how and where it was found.

Anybody know if anything similar has been found? And i'm not talking about the elongated skulls.

I always have a bad feeling about this skull.

How much can we trust him?
And, cant it just be a person, which had a building disease?

Like, if this is an 'alien', and they probably are way into the future, but they Don't know how to grow teeth probably??
That may sound like a silly statement, but I just cant imagine that this is a star child.

And for the "some of the dna is not human", Meh.

Originally posted by ThinkingCap
Part of the skull's DNA is not human.

Misleading.
If you watch the video what he ACTUALLY says is that
- one section of DNA was found to be perfectly normal human.
- another piece of DNA tested was not found in a DNA database.

Thats it. Not found in a database, to which they conclude it must be alien. No other possibilities are raised.


Me? A guy with a degree in Genetics? I'd say the most logical conclusions are...
- Its human, but lets face it the BLAST database does NOT contain samples of every bit of variation of every bit of DNA from every race that has ever existed for the last 900 years. Could be the bit tested was unusual, from a tribe of people who have since died out.
- The test is faulty in some manner. Cointamination does occur.
- The check against the database was too strict, and didnt ask for a wider look at variations.
- Its part of an intron. And the huge amount of variance over time and space means, like reasons 1, that its not in the database because it has changed so much.

Anyone who tells you "was found to be not human" is just LYING to you.

My intention wasn't to mislead, but I did word it lazily. I should have added a rational disclaimer, considering how little we actually know about extremely unique tribes of people such as this - it is more probable this is terrestrial.

Looking at the skull - this "Starchild" skull is less than half as thick as a human's. What of this?

Biochemistry of human bone (1:39) --

Calcium, phosphorous = high

oxygen, carbon = low

Starchild:

Carbon, Oxygen = Up

Phosphorous = low

---

I am not an expert on these things, but these appear to be huge differences between the two. Is it possible that we may be looking at a subterranean folk of people?

reply to post by alfa1

Thats it. Not found in a database, to which they conclude it must be alien. No other possibilities are raised.

I'm fairly sure they checked it against The Human Genome Project database.

www.ornl.gov...

Completed in 2003, the Human Genome Project (HGP) was a 13-year project coordinated by the U.S. Department of Energy and the National Institutes of Health. During the early years of the HGP, the Wellcome Trust (U.K.) became a major partner; additional contributions came from Japan, France, Germany, China, and others. See our history page for more information.

Project goals were to

• identify all the approximately 20,000-25,000 genes in human DNA,
  
• determine the sequences of the 3 billion chemical base pairs that make up human DNA,
  
• store this information in databases,
  
• improve tools for data analysis,
  
• transfer related technologies to the private sector, and
  
• address the ethical, legal, and social issues (ELSI) that may arise from the project.
  

Though the HGP is finished, analyses of the data will continue for many years. Follow this ongoing research on our Milestones page. An important feature of the HGP project was the federal government's long-standing dedication to the transfer of technology to the private sector. By licensing technologies to private companies and awarding grants for innovative research, the project catalyzed the multibillion-dollar U.S. biotechnology industry and fostered the development of new medical applications.

reply to post by ThinkingCap
The last Starchild thread was posted 3 days ago. The thread before that was posted in June this year and was still active on Friday.

There are dozens of Starchild threads and this one isn't bringing anything new to discuss. You even say it yourself!

In the past 6 months there are massive Starchild threads with 100s of flags each and page after page...why not add to those?

August 2011
JUNE 2011
March 2011

reply to post by ThinkingCap


It's called Hydrocephalus.

The poor child probably suffered for the few years it was alive.

As long as it make Pye rich though, it doesn't matter.

Originally posted by Kandinsky
August 2011
JUNE 2011
March 2011

None of those threads contain the amazing video presented by the OP.

reply to post by ChaoticOrder


If he posted it in them they would.

Originally posted by Chadwickus
reply to post by ChaoticOrder

 

If he posted it in them they would.

Judging by your first post in this thread you didn't even bother to watch the video presented by the OP. IMO it's worthy of it's own thread. I've seen A LOT of other threads with a worse premise. Why don't you go bug them.

reply to post by ChaoticOrder

post by ChaoticOrder
None of those threads contain the amazing video presented by the OP.

The "amazing video" contains nothing that hasn't been previously covered in the myriad of video's concerning the skull .
Its just another Starchild Skull thread , with nothing new to add.

Originally posted by ThinkingCap
My intention wasn't to mislead,

No, I was referring to Lloyd Pye (is that him in the video?)
Since I previously posted, I've been searching the net (and the starchild skull web page) to see if I can actually find out what the mysterious alien DNA sequence of 342 base pairs actually is.

The reason I want to know, is that I want to do the search myself.

The BLAST database referred to in the video is free and accessible to the public.
BLAST

As an example to yourself, go there and paste the following into the search window...

>Example
ATCACTGTAGTAGTAGCTGGAAAGAGAAATCTGTGACTCCAATTAGCCA
GTTCCTGCAGACCTTGTGAGGACTAGAGGAAGAATGCTCCTGGCTGTTT
TGTACTGCCTGCTGTGGAGTTTCCAGACCTCCGCTGGCCATTTCCCTAG
AGCCTGTGTCTCCTCTAAGAACCTGATGGAGAAGGAATGCTGTCCACCG
TGGAGCGGGGACAGGAGTCCCTGTGGCCAGCTTTCAGGCAGAGGTTCC

Now down in "Choose Search Set", select Nucleotide Collection (nr/nt)
Now down in "Program Selection". select More dissimilar sequences
Now, bottom left corner, click BLAST button and wait a minute for the results..
The result of the example I gave above is human, and matches many samples in the database.
Simple, wasnt it?

Now lets try it with the "non human" sequence of 342 base pairs.

Oh wait, you cant do it, because as near as I can tell he's keeping it a secret, cant find any reference to the actual sequence anywhere. Of course the documentation on the starchild skull web page mentions the HUMAN parts of DNA in a couple of places, but not the "non human".

So you're just going to have to take his word for it.
Personally, I think he's a lying conman

When I saw the title of the video, I was excited that perhaps some new information on it had come forth. I was a bit disappointed, because I've seen this man talk. But not with the picture detail in this video, which is why I thought this little mystery might be worth bringing up for some of those who hadn't seen it before.

Chadwickus -- Hydrocephalus you say? I hope you're wrong, I always thought this story was a bit more interesting than a simple con. What about the biochemistry of the bone as I've laid out above, have you found information proving this?

Originally posted by alfa1
Misleading.
If you watch the video what he ACTUALLY says is that
- one section of DNA was found to be perfectly normal human.
- another piece of DNA tested was not found in a DNA database.

Actually, what is misleading here is you. As someone who supposedly has a degree in Genetics; you should be well aware that much of the life on your planet shares DNA sequences. You should also be aware that there are non-human animals that are very close to Humans genetically.

Thats it. Not found in a database, to which they conclude it must be alien. No other possibilities are raised.

Yes, "jumping" to the conclusion that it is "alien" may be premature. However, "not found in a database" is certainly enough to qualify it as non-human (depending of course of the SQL used)

Me? A guy with a degree in Genetics? I'd say the most logical conclusions are...
- Its human, but lets face it the BLAST database does NOT contain samples of every bit of variation of every bit of DNA from every race that has ever existed for the last 900 years. Could be the bit tested was unusual, from a tribe of people who have since died out.
- The test is faulty in some manner. Cointamination does occur.
- The check against the database was too strict, and didnt ask for a wider look at variations.
- Its part of an intron. And the huge amount of variance over time and space means, like reasons 1, that its not in the database because it has changed so much.

Anyone who tells you "was found to be not human" is just LYING to you.

You may have such a degree, but, jumping to such conclusions as you have, is rather unscientific, and tends to make you more of a "Hack" than a real scientist.

Lets see ... the number of different Human species originating on Earth in the last 900 years ... that would be ONE wouldn't it? Perhaps several sub-species, but, still only ONE terrestrial Human!

Test was faulty!?? And these labs stay in business how? Contamination can happen, but is highly improbable. You contend that the search was "too strict", but, have you seen/read the SQL script executing that script? No? Didn't think so. You don't know howmany mutations they have allow for. Course, this script was probably written by a biologist, not unlike yourself, and that almost insures a somewhat faulty search. SQL is a simpe enough "looking" language, but to those unfamiliar, or inexperienced, it can be a serious pain the a$$ (spoken from 40 years experience)

It is always better, to speak from knowledge, and if you haven't reviewed their data, you have no knowledge.

Ya see, the problem here is that I could present DNA data from one of my Wolves, and if chosen carefully YOU would make the very same statements about the results. Yet, the fact remains; Wolves are non-human. (i'd almost like to see your opinion of Chimp DNA ... could be quite entertaining).

Lloyd came by the skull with no more provenance than his word for it.

He decided it was an alien hybrid and began asking for money to prove it wasn’t. He launched two websites and a book. One pushing the idea that humans were created by aliens and that evolution was BS. The other pushing the claim that ‘Starchild’ was alien.

He took it to a local doctor who told Lloyd it was an abnormal skull and human.

Lloyd disagreed and took it elsewhere whilst asking for money to prove it was alien.
They all told him the same thing.

Lloyd concluded they were lying or covering-up the truth and maintained the view that the skull was an alien hybrid. If only he had enough money, he could prove it.

He had it analysed by Dr David Sweet et al. This analysis showed that mom and dad were human.
Lloyd concluded that their analyses were sub-standard and that they were covering up or lying. He integrated himself onto the UFO and paranormal circuit and carried on asking for money whilst claiming that science, evolution and natural selection were ‘exactly wrong.’

In the past decade, he’s continued to accuse everyone who doesn’t share his conclusion as being ‘exactly wrong,’ lying or covering up. He’s never faltered from asking for money. He’s never faltered from the slogan of ‘Proof is around the corner.’

I think he’s a fraud and a conman. I could be wrong about the conman aspect and it’s possible that he genuinely believes he’s in possession of an alien skull. The fraud allegation stands because he’s decided, in the face of all evidence, that it’s alien and keeps asking for money on nothing more than what he believes to be so
.
Here we are in August 2011 and the same claims from years ago are still being made that *proof* is around the corner….if only more money was donated. The same argument will be getting posting on ATS next year.

Almost exactly a year ago...

[atsimg]http://files.abovetopsecret.com/images/member/2e79d18e4ff8.jpg[/atsimg]
Old thread

reply to post by ThinkingCap


...Still waiting for my question to be answered about the phosphorus/carbon levels...

Very interesting though Kandinsky. It appears from your perspective that this guy has been on a decade long vendetta to see how much small change he can muster by claiming the skull to be alien. I mean, he's definitely not paying rent spreading this skull around.

You say that both mother and father were human, and yet this exists:

Despite six attempts, the nuclear DNA did not react with any known human markers. This meant the father of the Starchild was not human.

What do we know from these 2003 tests? We know that:

(1) The DNA in both samples was exceptionally well preserved after 900 years.
(2) The mitochondreal DNA recovery proved the Starchild's mother was undoubtedly human.
(3) The Starchild's nuclear DNA was viable, but not recoverable by human-only primers.

Combining the last two of those left only one stark and startling conclusion:
By knowing the Starchild's mother was human, and by knowing its nuclear DNA was viable but not responding to human-only primers, that could only mean that the father was causing the primer keys to fail to find their specific human locks.

The father wasn't entirely human!

Father Hybrid?

Originally posted by Kandinsky
I think he’s a fraud and a conman. I could be wrong about the conman aspect and it’s possible that he genuinely believes he’s in possession of an alien skull. The fraud allegation stands because he’s decided, in the face of all evidence, that it’s alien and keeps asking for money on nothing more than what he believes to be so

I would challange you, or indeed anyone else, to explain his data!

Although, I will give you; He hasn't produced anything peer reviewed. It seems to me that he does infact have enough data to release something for review.

Thinking about it; Perhaps all the skeptics, beleivers (includeing myself), and even Pye should STFU until Pye releases his data for review and makes samples available.

reply to post by AnthraAndromda

Perhaps all the skeptics, believers (including myself), and even Pye should STFU until Pye releases his data for review and makes samples available.

Starred.

No threads and no publicity until he has enough to make a stand.

No doubt, we'll see at least 4 new threads in the next 4 months acting like Pye and his skull are something 'OMFG NEW!!!'

Originally posted by ThinkingCap
My intention wasn't to mislead, but I did word it lazily. I should have added a rational disclaimer, considering how little we actually know about extremely unique tribes of people such as this - it is more probable this is terrestrial.

Looking at the skull - this "Starchild" skull is less than half as thick as a human's. What of this?

Biochemistry of human bone (1:39) --

Calcium, phosphorous = high

oxygen, carbon = low

Starchild:

Carbon, Oxygen = Up

Phosphorous = low

---

I am not an expert on these things, but these appear to be huge differences between the two. Is it possible that we may be looking at a subterranean folk of people?