It looks like you're using an Ad Blocker.

Please white-list or disable in your ad-blocking tool.

Thank you.


Some features of ATS will be disabled while you continue to use an ad-blocker.


How do traits evolve? Where do traits come from?

page: 3
<< 1  2    4 >>

log in


posted on Dec, 10 2019 @ 08:46 PM

originally posted by: TzarChasm
a reply to: neoholographic

if it can happen "by design" then it can happen by accident, the means are viable and so the probability has been demonstrated. evolution can be artificed in small degrees by modern technology but the planet has been doing it for hundreds of millions of years, just like birds inspiring planes. maybe we are just dumb and have a hard time keeping up with basic engineering that is common sense to nature.

What you're saying doesn't make any sense. The fact is, believing in Santa Claus makes more sense than believing in a natural interpretation of evolution. Here's another example. Intelligence can encode sequence with information using any medium. The medium doesn't encode itself and is basically meaningless. It's just in a sequence Designed by Intelligence to convey a message or provide instructions. Look at computer code.

[b][/b] only means something in this sequence because intelligence Designed this sequence to bold a text and intelligence designed the machinery to read the information encoded on the sequence.

To accept the fantasy of evolution, you would have to believe a mutation is intelligent and it encodes the mutated sequence with it's meaning. So when CTC codes for Glutamic Acid and a mutation occurs and you get CAC, the mutation or the medium that's being mutated didn't encode the sequence CAC to code for Valine.

It would be like nature designing snowflakes and the snowflakes are encoded with information to build snowmen and it's encoded with the information to build the snowmen. It sounds nutty when you hear it but this is what a natural interpretation of evolution is saying. It's saying the medium and mutations can encode itself randomly with sequences that that also build the machinery to read these sequences. This machinery can be made up of all these different parts that just work together. INSANE!

How can anything random create parts that just work together to carryout a specific function? Logically, I know when I buy a toy that needs to be put together with 100's of different parts, these parts were designed to work together to carry out a function.

We were inspired by birds to fly, we used technology designed by intelligence to build planes.

I can encode information on 3 rocks. The rocks themselves have nothing to do with the information encoded in their sequence. That's designed by intelligence. This is no different than DNA. DNA was used by intelligence because it's an incredibly storage medium. I can encode the genetic code using anything.

|| = A, |] = C, ]] =T and ]|= G.

The medium doesn't encode sequence with anything. The medium is just used by intelligence to encode information.

I can say if you see 3 rocks on my table and the 1st rock is in a higher position than the 2nd rock and the 2nd rock is in a higher position than the 3rd rock in a diagonal left to right pattern, then call me on my work phone.

I can then say if the 3 rocks are in a diagonal pattern going from right to left with the 1st rock lower than the 2nd rock and the 2nd rock lower than the 3rd rock then call me on my cell phone.

The rocks themselves are just the medium. They have nothing to do with the information encoded on their sequence.

DNA is no different than the rocks, DNA is the medium which can store vasts amounts of data. This is why a designer would choose this medium.

So, to accept a natural interpretation of evolution, it would be like saying the rocks encoded their sequence with the information call me at work or call me on my cell phone.

The sequence is encoded by intelligence and it's decoded by another intelligent mind or machinery designed to read the information encoded on it's sequence.

DNA would have to encode it's sequence first to each amino acid that's used to build proteins, then code the sequence of proteins that form a polypeptide chain to fold into a protein. It would have to encode on a sequence where to stop and to start and it would have to encode itself with the information to build these small molecular machines sometimes made up of 100 different parts that just work together to carry out a specific function.

It's easy to see that an Intelligent Designer is needed. The sequence of the medium just stores information encoded by intelligence. The medium can't encode it's sequence with information and build he machinery to decode that information.
edit on 10-12-2019 by neoholographic because: (no reason given)

posted on Dec, 10 2019 @ 08:59 PM
a reply to: neoholographic
You totally nailed smart.

posted on Dec, 10 2019 @ 09:57 PM

originally posted by: vethumanbeing
a reply to: neoholographic
You totally nailed smart.

Thanks and like I said, it's just basic common sense but when you have a belief in a natural interpretation of evolution, common sense is thrown out of the window.

If I say, if you see a white sock lying in the middle of my room, meet me at Taco Bell on MLK but if you see a blue sock lying in the middle of my room, meet me at Chipolte Downtown.

I have just encoded the sequence of my socks with information that can be decoded by another intelligent mind or I can build machinery to decode the sequence.

A natural interpretation is like saying the socks encoded themselves with information.

Most people will acknowledge, that the notion of a medium encoding its sequence with information and then building machinery to decode the information is impossible.

With evolution you're dealing with belief. If you're an Atheist then you have to accept the impossible and illogical.

In this case the medium and random mutations would have to encode it's sequence with how to build proteins, the information to regulate the expression of these proteins, when to start and stop reading a sequence, machinery to read the sequence and carry out transcription and translation, machinery to do error correction and go and get the right amino acid to fit onto the right position of the polypeptide chain based on the code.

So, if you are an atheist or a materialist, you have to accept the illogical to maintain your belief system.

[b]bold[/b] is just a sequence designed by intelligence to make your text bold. Intelligence also designed the machinery(computer) to read the sequence and make the text bold. The letters and symbols and the sequence of the letters and symbols mean nothing by themselves. Their sequence only has meaning because of an Intelligent Designer.

The Designer could have used an h for highlighted or l for loud instead of a b for bold and you would still get the same thing. It makes no sense to say the medium can encode itself with information and build machinery to decode that information. You have to have an Intelligent Designer to do this with 3 rocks or with DNA.

posted on Dec, 11 2019 @ 07:57 AM
a reply to: neoholographic

The fact is, believing in Santa Claus makes more sense than believing in a natural interpretation of evolution.

But that literally isnt a fact at all.

DNA would have to encode it's sequence first to each amino acid that's used to build proteins, then code the sequence of proteins that form a polypeptide chain to fold into a protein. It would have to encode on a sequence where to stop and to start and it would have to encode itself with the information to build these small molecular machines sometimes made up of 100 different parts that just work together to carry out a specific function. 

It's quite astonishing what natural processes are capable of achieving without intelligent aid. Your incredulity isnt really a factor. The only difference you can make here is to introduce us to the intelligent agency that created life on this planet. Invite them to participate in some kind of AMA on this forum. Otherwise it's a moot argument.

posted on Dec, 11 2019 @ 01:02 PM

originally posted by: cooperton

originally posted by: Barcs
Another useless thread repeating all the same bull# as always. Maybe one day an honest creationist will post here and not need to lie about genetics and evolution. Wishful thinking LOL.

You're a thorn in every thread you enter. How about some peaceful productive input for once?

I'm trying to save people's sense of logic and reason.

The OP has made this same topic dozens of times. Literally nothing new has been brought up here, just the same dishonest assertions about evolution.
edit on 12 11 19 by Barcs because: (no reason given)

posted on Dec, 12 2019 @ 08:36 AM

originally posted by: Barcs

originally posted by: cooperton

originally posted by: Barcs
Another useless thread repeating all the same bull# as always. Maybe one day an honest creationist will post here and not need to lie about genetics and evolution. Wishful thinking LOL.

You're a thorn in every thread you enter. How about some peaceful productive input for once?

I'm trying to save people's sense of logic and reason.

The OP has made this same topic dozens of times. Literally nothing new has been brought up here, just the same dishonest assertions about evolution.

And the same suspicious silence from this hypothetical creation figure.

posted on Dec, 12 2019 @ 10:03 AM

originally posted by: Barcs

I'm trying to save people's sense of logic and reason.

By trying to convince them they are mutant monkey offspring from meaningless pond goo? Do you realize that this material reductionist philosophy destroys the minds of developing youths into thinking they are meaningless? Do you know what it feels like to be meaningless? It leads to all sorts of suicidal and nihilist thoughts, and justifies all sorts of atrocities because "nothing matters anyway". Just stop. Even if you are right, against all odds, then it doesn't matter what you believe anyway. So there is no reason you should even speak your opinion, if you are a true believer in atheism...

originally posted by: TzarChasm
And the same suspicious silence from this hypothetical creation figure.

What sign do you want? You wouldn't be convinced even if someone rose from the dead and conquered death in the name of the Creator.

posted on Dec, 12 2019 @ 04:55 PM
a reply to: cooperton

Good points! Here's another example to show how silly a natural interpretation of evolution is.

Let's say I have a red cup and a blue cup and I say if the red cup is faced down and the blue cup is faced up then meet me at Longhorn on MLK. If the red cup is faced up and the blue cup is faced down, meet me at Olive Garden on 4th St. Downtown.

I have just encoded information on the sequence of the cups. The cups contain no information. There just the medium. This is the same with DNA. DNA is just a storage medium and we have learned that it's a very powerful storage medium.

DNA could store all of the world's data in one room

It's a storage medium.

It doesn't create information, it stores it. We have stored things like books and CD's on DNA because we know the code. DNA, doesn't create the information from the book or CD. Intelligence creates that information and DNA stores it on its sequence.

Let's go back to the above example. Intelligence can keep storing information on a medium's sequence. How long this information stays encoded depends on how durable the storage medium is. So I can say:

I have a red cup and a blue cup and I say if the red cup is faced down and the blue cup is faced up then meet me at Longhorn on MLK and catch an uber and I will take you home..

If the red cup is faced up and the blue cup is faced down, meet me at Olive Garden on 4th St. Downtown and drive your car because I have to go back to the office after we eat.

In the bold text, I just added more information into the same sequence! The cups don't encode its sequence with information. It's crazy that I have to even argue this point but a natural interpretation of evolution is a blind belief so people who support it will accept the illogical.

Here's a Genetic Code chart.

Met is usually the start codon with AUG and you can see the stop codons. Here you have a sequence that's encoded with information. It also builds the machinery to read the information encoded on a sequence. A sequence will look like this:


Now translation knows where to start. This code is transcribed into mRNA then translated. This is of course shortened and simplified.

Reading the chart, you get the amino acid Proline then Aspartic Acid. We know this because this information encoded on it's sequence. This has to come from intelligence.

The information encoded on its sequence is abstract. Like, meet me at Longhorn at 4 PM or you can build the machinery to assemble a microwave. The information to build the microwave comes from an intelligent mind. The parts of the microwave don't encode instruction on how to build a microwave.

DNA is the same thing. As intelligent minds, we recognize this and can use the code to encode information like a book or CD. You can write code now on a computer, that code will then be compiled into DNA and the computer code you write can be inserted into bacteria. Here's more from Yockey:

The book Information Theory, Evolution and the Origin of Life is written by Hubert Yockey, the foremost living specialist in bioinformatics. The publisher is Cambridge University press. Yockey rigorously demonstrates that the coding process in DNA is identical to the coding process and mathematical definitions used in Electrical Engineering. This is not subjective, it is not debatable or even controversial. It is a brute fact:

“Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in biology. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

A natural interpretation belongs on Fantasy Island with Tattoo!

posted on Dec, 13 2019 @ 08:23 AM
a reply to: cooperton

I probably wouldnt be. Im the sort of person who believes any sort of authority position requires actual leadership skills and not just necromancy that is convenient for their personal agenda.

posted on Dec, 13 2019 @ 08:36 AM

originally posted by: neoholographic
a reply to: cooperton

Good points! Here's another example to show how silly a natural interpretation of evolution is.

Let's say I have a red cup and a blue cup and I say if the red cup is faced down and the blue cup is faced up then meet me at Longhorn on MLK. If the red cup is faced up and the blue cup is faced down, meet me at Olive Garden on 4th St. Downtown.

I have just encoded information on the sequence of the cups. The cups contain no information. There just the medium. This is the same with DNA. DNA is just a storage medium and we have learned that it's a very powerful storage medium.

DNA could store all of the world's data in one room

It's a storage medium.

It doesn't create information, it stores it. We have stored things like books and CD's on DNA because we know the code. DNA, doesn't create the information from the book or CD. Intelligence creates that information and DNA stores it on its sequence.

Let's go back to the above example. Intelligence can keep storing information on a medium's sequence. How long this information stays encoded depends on how durable the storage medium is. So I can say:

I have a red cup and a blue cup and I say if the red cup is faced down and the blue cup is faced up then meet me at Longhorn on MLK and catch an uber and I will take you home..

If the red cup is faced up and the blue cup is faced down, meet me at Olive Garden on 4th St. Downtown and drive your car because I have to go back to the office after we eat.

In the bold text, I just added more information into the same sequence! The cups don't encode its sequence with information. It's crazy that I have to even argue this point but a natural interpretation of evolution is a blind belief so people who support it will accept the illogical.

Here's a Genetic Code chart.

Met is usually the start codon with AUG and you can see the stop codons. Here you have a sequence that's encoded with information. It also builds the machinery to read the information encoded on a sequence. A sequence will look like this:


Now translation knows where to start. This code is transcribed into mRNA then translated. This is of course shortened and simplified.

Reading the chart, you get the amino acid Proline then Aspartic Acid. We know this because this information encoded on it's sequence. This has to come from intelligence.

The information encoded on its sequence is abstract. Like, meet me at Longhorn at 4 PM or you can build the machinery to assemble a microwave. The information to build the microwave comes from an intelligent mind. The parts of the microwave don't encode instruction on how to build a microwave.

DNA is the same thing. As intelligent minds, we recognize this and can use the code to encode information like a book or CD. You can write code now on a computer, that code will then be compiled into DNA and the computer code you write can be inserted into bacteria. Here's more from Yockey:

The book Information Theory, Evolution and the Origin of Life is written by Hubert Yockey, the foremost living specialist in bioinformatics. The publisher is Cambridge University press. Yockey rigorously demonstrates that the coding process in DNA is identical to the coding process and mathematical definitions used in Electrical Engineering. This is not subjective, it is not debatable or even controversial. It is a brute fact:

“Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in biology. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

A natural interpretation belongs on Fantasy Island with Tattoo!

If intelligent design is so easily reverse engineered then why haven't humans being upgraded in the last few thousand years? Why are homo sapiens still the most advanced species when we can easily improve on so called divine design using the same tools written in your bible? Why is it so hard to fix our world when its a simple matter of coding?

posted on Dec, 13 2019 @ 08:51 AM

originally posted by: moebius
a reply to: neoholographic

For every successful mutation there have been countless failures/errors. More DNA changes are harmful than being beneficial. The harmful ones are then weeded out by natural selection.

Intelligent design proponents like you only see the successful mutations and then arrive at the erroneous assumption that those mutations could not have happened by chance.

The guy can't count from 1-10 much less understand the statistics of mutation. Just another poorly educated, died-in-the-wool Creationist who has the science IQ of a hamster.

posted on Dec, 13 2019 @ 10:03 AM
a reply to: cooperton

LOL @ your silly straw man arguments.

posted on Dec, 14 2019 @ 01:46 AM

originally posted by: TzarChasm

originally posted by: neoholographic
a reply to: cooperton

Good points! Here's another example to show how silly a natural interpretation of evolution is.

Let's say I have a red cup and a blue cup and I say if the red cup is faced down and the blue cup is faced up then meet me at Longhorn on MLK. If the red cup is faced up and the blue cup is faced down, meet me at Olive Garden on 4th St. Downtown.

I have just encoded information on the sequence of the cups. The cups contain no information. There just the medium. This is the same with DNA. DNA is just a storage medium and we have learned that it's a very powerful storage medium.

DNA could store all of the world's data in one room

It's a storage medium.

It doesn't create information, it stores it. We have stored things like books and CD's on DNA because we know the code. DNA, doesn't create the information from the book or CD. Intelligence creates that information and DNA stores it on its sequence.

Let's go back to the above example. Intelligence can keep storing information on a medium's sequence. How long this information stays encoded depends on how durable the storage medium is. So I can say:

I have a red cup and a blue cup and I say if the red cup is faced down and the blue cup is faced up then meet me at Longhorn on MLK and catch an uber and I will take you home..

If the red cup is faced up and the blue cup is faced down, meet me at Olive Garden on 4th St. Downtown and drive your car because I have to go back to the office after we eat.

In the bold text, I just added more information into the same sequence! The cups don't encode its sequence with information. It's crazy that I have to even argue this point but a natural interpretation of evolution is a blind belief so people who support it will accept the illogical.

Here's a Genetic Code chart.

Met is usually the start codon with AUG and you can see the stop codons. Here you have a sequence that's encoded with information. It also builds the machinery to read the information encoded on a sequence. A sequence will look like this:


Now translation knows where to start. This code is transcribed into mRNA then translated. This is of course shortened and simplified.

Reading the chart, you get the amino acid Proline then Aspartic Acid. We know this because this information encoded on it's sequence. This has to come from intelligence.

The information encoded on its sequence is abstract. Like, meet me at Longhorn at 4 PM or you can build the machinery to assemble a microwave. The information to build the microwave comes from an intelligent mind. The parts of the microwave don't encode instruction on how to build a microwave.

DNA is the same thing. As intelligent minds, we recognize this and can use the code to encode information like a book or CD. You can write code now on a computer, that code will then be compiled into DNA and the computer code you write can be inserted into bacteria. Here's more from Yockey:

The book Information Theory, Evolution and the Origin of Life is written by Hubert Yockey, the foremost living specialist in bioinformatics. The publisher is Cambridge University press. Yockey rigorously demonstrates that the coding process in DNA is identical to the coding process and mathematical definitions used in Electrical Engineering. This is not subjective, it is not debatable or even controversial. It is a brute fact:

“Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in biology. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

A natural interpretation belongs on Fantasy Island with Tattoo!

If intelligent design is so easily reverse engineered then why haven't humans being upgraded in the last few thousand years? Why are homo sapiens still the most advanced species when we can easily improve on so called divine design using the same tools written in your bible? Why is it so hard to fix our world when its a simple matter of coding?

There's several reasons.

1. Science
2. Technology
3. Ethical concerns

Your question is like, why didn't we have smartphones in 1980?

First, we have come along way because as intelligent minds we understand the intelligent code that was designed. Crick and Watson discovered the double helix structure of DNA in 1953. The first human genome was sequenced in 2003.

These things don't happen overnight.

Computers go back to 1822 with Charles Babbage maybe even further. Why did it take so long to be able to Facetime? According to yo, all this is just so simple and we don't have to wait for science and technology to progress.

We have come a very long way though. We're cloning animals and the Biodesign industry is booming!

A Guide To The $13.4 Billion Biodesign Industry


Put simply, biodesign is the intersection between biology and design: It’s a growing movement (literally) of scientists, artists, and designers that integrates organic processes and materials into the creation of our buildings, our products, and even our clothing. That can mean, for example, growing a chair out of mycelium, the mushroom fungus that makes for a surprisingly durable material for furniture. It can mean actually altering the DNA of living organisms using genetic engineering techniques, such as with GMO foods.

We can do all of this because we understand the code!

Finally, we would have human clones by now and Designer babies if it wasn't for ethical concerns. Here's more about Programming DNA.

Programming the genome with CRISPR

A scientist has a DNA sequence of interest and wants a list of all CRISPR targets contained in the sequence. Finding every target by hand is tedious and error prone.

The scientist wants a simple program where they can input a DNA sequence and have all possible Cas9 target sites returned. The scientist would also like the cut position and PAM sequence for each target site.


EXAMPLE OUTPUT: [[ 'cut_pos': 6, 'pam_seq': 'TGG', 'target_seq': 'GTATGGGGCTACAGAAACCG',

The reason we can do this is because an intelligent mind can decode the information encoded on sequences of DNA. Also, I wouldn't be surprised if human clones exist today and 5 years from now some Scientist says 10 clones live among us and we don't need to treat them any differently.

We would be even further along but there's many ethical concerns but we have came along way using this intelligent designed code in DNA

edit on 14-12-2019 by neoholographic because: (no reason given)

posted on Dec, 14 2019 @ 06:37 AM
a reply to: moebius

Where is all the proof of these falures?

posted on Dec, 14 2019 @ 11:04 AM

originally posted by: TzarChasm
a reply to: cooperton

I probably wouldnt be. Im the sort of person who believes any sort of authority position requires actual leadership skills and not just necromancy that is convenient for their personal agenda.

Leadership skills such as willing to die for their truth that cause no one harm? Jesus epitomized every archetypal trait of a good leader. Why do you have such resentment towards him?

posted on Dec, 14 2019 @ 07:15 PM
a reply to: neoholographic

So if I'm following correctly, this "coding" process takes so long because there are what you might call rules? The same way you can't just write a simple sentence in the command prompt box. "Hide my porn folder" You have to know how to speak the language. But how was the language of genetics invented? This would suggest some nonorganic life designed the first genome and wrote its lexicon. But who designed nonorganic life so that it would proceed to invent organic biology? And surely anything capable of such technical prowess must have been designed by an even greater creature...

posted on Dec, 14 2019 @ 07:27 PM

originally posted by: cooperton

originally posted by: TzarChasm
a reply to: cooperton

I probably wouldnt be. Im the sort of person who believes any sort of authority position requires actual leadership skills and not just necromancy that is convenient for their personal agenda.

Leadership skills such as willing to die for their truth that cause no one harm? Jesus epitomized every archetypal trait of a good leader. Why do you have such resentment towards him?

Repeat that first line again, slowly.

If someone dies, it's not harmless. If people keep dying, it's not harmless. And any fantasy buff worth their book collection knows that any time someone dies and comes back after rotting for a couple days (or centuries) it's necromancy. Usually requires some kind of unethical trade like sacrificing your firstborn son in a brutally violent manner.

posted on Dec, 14 2019 @ 09:18 PM

originally posted by: moebius
a reply to: neoholographic

For every successful mutation there have been countless failures/errors. More DNA changes are harmful than being beneficial. The harmful ones are then weeded out by natural selection.

Intelligent design proponents like you only see the successful mutations and then arrive at the erroneous assumption that those mutations could not have happened by chance.

This is just wrong.

Natural selection weeds out nothing. This occurs through error correction before anything reaches the environment. An Intelligent Designer knows that noise and errors will corrupt the code and the data that you're trying to transmit will be corrupted without error correction.

This has nothing to do with natural selection and everything to do with things like redundancy.

We couldn't be on the computer right now or using any communication channels that transmits data without error correction. Organisms would never evolve without error correction because they would be so damaged by errors(mutations) before they even reach the environment.

Natural selection does nothing. By the time these traits reach the environment, there's mostly genomes throughout the population that don't have harmful mutations. So when these mutations do reach the environment, they can't do any harm to the population as a whole because of error correction.

First, the Designer used redundancy when designing the code. This means different 3 letter codons code for the same amino acid. Secondly, if you get something like this:


Uracil (U) is used instead of thymine (T) for mRNA. This would mean the code is fine when doing error correction. Say you get this:


A mutation occurred and without error correction this mutation would reach the environment. Error correction flips the C to a U and then the DNA strands go through transcription and translation.

A is always paired with T(U) and G with C. You can see why an intelligent designer used double strands in order to do error correction and check one strand against another.

You don't need natural selection to weed anything out. Without error correction, you wouldn't have evolution because genes would be overrun with errors and you wouldn't get any organisms. There's nothing for natural selection to do because the times these traits reach the environment, many of them are error free because of error correction. The harmful ones that make it to the environment don't need to be weeded out because the ratio of harmful mutations vs genomes without those harmful mutations is huge and this allows organisms to evolve.

Things like error correction, redundancy, transcription and translation is used when intelligence encodes sequence with information and also builds the machinery to decode the information.

The book Information Theory, Evolution and the Origin of Life is written by Hubert Yockey, the foremost living specialist in bioinformatics. The publisher is Cambridge University press. Yockey rigorously demonstrates that the coding process in DNA is identical to the coding process and mathematical definitions used in Electrical Engineering. This is not subjective, it is not debatable or even controversial. It is a brute fact:

“Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in biology. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

So natural selection does nothing. Harmful mutations can't accumulate fast enough to destroy an organism because of error correction.
edit on 14-12-2019 by neoholographic because: (no reason given)

posted on Dec, 15 2019 @ 01:11 AM

originally posted by: Barcs
Another useless thread repeating all the same bull# as always. Maybe one day an honest creationist will post here and not need to lie about genetics and evolution. Wishful thinking LOL.

I am a creationist as in capitals: THE. I do not lie or apologize for any mistakes, restarts, destruction's or corrections of systems. This is a laboratory planet. You are the experiment (ask me how/why).

posted on Dec, 20 2019 @ 08:16 PM
It is easy to see intelligent design when you are looking for intelligent design; it is kind of like seeing the paranormal in a coincidence - the odds may be astronomical and they should be.
In both cases if you are only looking at the winning lottery ticket you must remember the odds and all those tickets that did not win.
Genetic evolutionary change may be random; the change is not looking to fulfill a mission - a change caused from solar radiation will only have an astronomical chance of being repeated or passed on.

top topics

<< 1  2    4 >>

log in
