How Did RNA & DNA Come Into Existence ?

a reply to: Duderino

Life without magic would be boring...

For example, look at Ginger, look how it grows... that’s magic!

& quarts crystals...

We don’t “grow” it it grows it’s self with the right conditions we give it... hmm

originally posted by: 57ORM1IV
so Someone something say there non existing with pen & paper and PLANNED IT ALL! LMAO

It’s human to try explain everything
but some things have no explanation...

like God.

"God" doesn't even have a good definition, and using it as an explanation for anything is exactly the same as saying "I don't know."

a reply to: Blue Shift

No, God is a Absolute .... but yes the big picture I can only see so much of it. As can you.

originally posted by: 57ORM1IV
a reply to: Blue Shift

No, God is a Absolute .... but yes the big picture I can only see so much of it. As can you.

Ugh.

a reply to: Blue Shift

No “God” the word, like Good and Evil ... they are absolute in nouns...
brainwashing pahahaha!

a reply to: Blue Shift



“There’s no gooding or eviling only goding”

hahaha!



I forgot about the (A) men

a reply to: whereislogic

A JoHo site? Bwhaaa

Try some peer reviewed stuff

originally posted by: Noinden

Try some peer reviewed stuff

Monomers aren't the hard part. The difficult part is polymerizing it into coherent RNA / DNA sequences that code for proteins. This along with the proper machinery to be able to translate it into proteins. It's unobtainable by random chance. The transcription and translation mechanisms present in even the most basic organism require a multitude of proteins and co-factors, along with a homeostatic environment to be able to function.

a reply to: cooperton
You call yourself a chemist... they do it because of their chemical nature.

originally posted by: Noinden
a reply to: cooperton
You call yourself a chemist...

This is not self-assembly. The scientists set-up isolated conditions and used pre-configured nucleic acid strands:

"Along this line, two sequences were chosen first: CGCAATTGCG, which is self-complementary, i.e. can hybridise with another strand of the same sequence and thus form a rigid, squat helix; and CGCAATTGCGTTTTTTTTTT, which is only partially self-complementary, forming a helix with two long, dangling tails. "

They're actually talking about the crystallization, or the spontaneous formation of the secondary structure helices. The paper isn't saying what you think it is. At all. You thought it meant the spontaneous polymerization of nucleic acid monomers into polymers, but that's not what it is referring to.

Stop wasting my time with erroneous papers that you don't read.

they do it because of their chemical nature.

1) you don't have access to this paper, so you can't even read their methods

2) this isn't replicating pre-biotic conditions (nor do they claim to be doing so) because they use: "in-vitro synthesised protein", "an artificial protein scaffold", and "a streptavidin-based protein vector "

Please stop wasting my time with erroneous papers that you don't read. Next time reference an excerpt from the paper that you think supports your opinion, rather than making me go fish in a sea with no fish.

a reply to: cooperton

Oh look you decide what is and is not Self assembly.

The second paper you claim I don't have access too. Is free to all so you failed there.

I have access to most papers. I work in the sciences, so yeah we need to get access to peer reviewed papers.

Again you are shifting the goal posts. But you are wrong.

If you don't want to engage, feel free to bow out. Go back to editing your funny little facebook page attacking atheists

originally posted by: Noinden
a reply to: cooperton

Oh look you decide what is and is not Self assembly.

No I am showing you that it is not referring to nucleic acid polymerization, it is referring to the spontaneous formation of the secondary structure, not the primary structure. There is a major difference.

Don't change the subject.

a reply to: cooperton

NO, you are shifting the goal posts. Which is what you do when someone throwssomething at you you don't understand. If nucleic acids can be induced to self assemble in the lab, it kind of means its something it does.

a reply to: cooperton

Interesting you edited your reply after I replied .... a tad dodgy. You did that in at least two replies too.

a reply to: cooperton

You seem to still be hamstrung by forcing abiogenisis (a hypothesis) on evolution (a therory). You insist that the lack of answers to your "it must be so" demands is the end of evolution. But Bryan, no its not. There are plenty of hypotheses about this. Its your stubbornness, that causes you to ignore the options.

a reply to: Noinden

by forcing abiogenisis (a hypothesis) on evolution (a therory)

For the billionth time, you may skip the foundation of an ideological scientific concept, but we won't.
This is why you will NEVER convince us, ever.

Likewise BlueJay.

a reply to: Klassified

What have you actually proven, in your opinion?

Blue Jays answer to this great question was awesome and if I may?

I think he is right and what that proves is that we aren't just a miracle.
Which is what science suggests.

you All are forgetting the conditions in the lab the oxygen in air the temperature everything that relates to synthesis of DNA 🧬 they all had to be in place in the beginning, or it wouldn’t exist.

originally posted by: Noinden If nucleic acids can be induced to self assemble in the lab, it kind of means its something it does.

You have to understand this difference:

primary nucleic acid structure involves the polymerization of base pairs. It does not happen spontaneously

Secondary structure is the shape (i.e. helices) that this sequence takes. It happens spontaneously

Read the paper, they are referring to spontaneous secondary structure helices, whereas they insert the primary structure as a given. The paper you sent does not show self-assembly of the primary structure.