The Case Against Playing in the Evolution Court.

a reply to: Akragon

That's true for your kind.

a reply to: cooperton

If we are actually children of the Creator, then having the false belief that we are mutant monkeys would detract us from what we actually are, missing out on exploring the depths of the gift of God while we live. Whereas if we are actually mutant ape progeny, then it really doesn't matter what we believe because we are the children of indifferent processes and will return to nothingness once we pass.

Your guy in the sky doesn't seem to agree with you. If you are the child of the Creator and the monkey is not, why did your guy in the sky give the monkey 96%+ genetic compatibility with humans? Why aren't the genes of your "mutant ape" entirely different than the genes of the "children of the Creator"? Why does your mutant ape and humans have the same capacity for mutation? Is your guy in the sky confused or are you confused???

a reply to: Phantom423

I can't figure out this word salad. Come again?

originally posted by: Out6of9Balance
a reply to: Phantom423

I can't figure out this word salad. Come again?

That's easy. You obviously don't speak the King's English. You and Coop might consider going back to school - perhaps they'll give you a discount for a double enrollment.

In the meantime, can you post a link to a biology book that says that humans came from mutant apes? I'd really like to get an answer to that question. Since you're a member of the lame, lazy and crazy crowd, maybe you would like to share some of your resources?

originally posted by: Phantom423

Could you please post a link to a biology book that says that humans are descendants of mutant apes. You can't because the science of evolution never said that, does not say that and will never say that.

The ancestor of humans was in the great ape family. This predecessor in the ape family is theorized to have mutated over the years into homo sapiens. That is exactly what the theory says. Humans are descended from a mutated predecessor from the ape family.

You don't even understand your own theory.

originally posted by: cooperton

originally posted by: Phantom423

Could you please post a link to a biology book that says that humans are descendants of mutant apes. You can't because the science of evolution never said that, does not say that and will never say that.

The ancestor of humans was in the great ape family. This predecessor in the ape family is theorized to have mutated over the years into homo sapiens. That is exactly what the theory says. Humans are descended from a mutated predecessor from the ape family.

You don't even understand your own theory.

Once again, please post a link to a biology book which says that humans descended from a mutated ape. You have made this statement hundreds of times and have yet to post a link where the science of evolution says that.

Now don't forget to disappear into the aether like you usually do.

originally posted by: Out6of9Balance
a reply to: Akragon

That's true for your kind.

what does that even mean?

my kind? Educated? Non religious?

wtf?

originally posted by: cooperton

originally posted by: Phantom423

Could you please post a link to a biology book that says that humans are descendants of mutant apes. You can't because the science of evolution never said that, does not say that and will never say that.

The ancestor of humans was in the great ape family. This predecessor in the ape family is theorized to have mutated over the years into homo sapiens. That is exactly what the theory says. Humans are descended from a mutated predecessor from the ape family.

You don't even understand your own theory.

5, 4, 3, 2, 1 -- okay you lost. Once again, for the umpteenth time, you can't post a valid link that supports your position.

Did humans evolve from mutants apes? NO.
Did mutant apes evolve into humans? NO.

Will apes become humans? NO.
Will humans become apes? NO (there are certain exceptions on this board, however, although I don't want to insult apes)

Do apes and humans have 96%+ of their genes in common? YES
What does that mean???????????????????????????????????????????????????????????????

It means that apes and humans have a common ancestor!

They say we even have genes in common with the banana plant.

The banana plant is the common ancestor.

a reply to: Akragon

So educated and non-religious is what you highly value. I'm not sure what you think of that to be. It must be good.

originally posted by: Phantom423

5, 4, 3, 2, 1 -- okay you lost. Once again, for the umpteenth time, you can't post a valid link that supports your position.

Did humans evolve from mutants apes? NO.

You're developing a psychosis trying to kill Moby Dick. Humans are in the family of Great Apes, meaning their theorized ancestors were also in the great ape family. A line of creatures within the Ape family are theorized to have mutated over time into the modern homo sapien.

Do apes and humans have 96%+ of their genes in common? YES

This is a silly myth. Humans have a genome that is 4% smaller than chimpanzees, how could they have more than 96% of their genome in common hahaha? (chimpanzee genome length, homo sapien genome length) And also, how could losing 130,000,000 base pairs from the chimpanzee to the homo sapien cause developmental advances? It is absurd. The theory is wrong. It's just a matter of time until the blind zeal settles down.

originally posted by: Out6of9Balance
They say we even have genes in common with the banana plant.

The banana plant is the common ancestor.

It happens to be true. But it sounds like you're thoroughly amazed by this fact. Why don't you look it up?

You really need to go back to school and learn a little about this modern world we live in. I think you're stuck in the 12th century.

originally posted by: cooperton

originally posted by: Phantom423

5, 4, 3, 2, 1 -- okay you lost. Once again, for the umpteenth time, you can't post a valid link that supports your position.

Did humans evolve from mutants apes? NO.

You're developing a psychosis trying to kill Moby Dick. Humans are in the family of Great Apes, meaning their theorized ancestors were also in the great ape family. A line of creatures within the Ape family are theorized to have mutated over time into the modern homo sapien.

Do apes and humans have 96%+ of their genes in common? YES

This is a silly myth. Humans have a genome that is 4% smaller than chimpanzees, how could they have more than 96% of their genome in common hahaha? (chimpanzee genome length, homo sapien genome length) And also, how could losing 130,000,000 base pairs from the chimpanzee to the homo sapien cause developmental advances? It is absurd. The theory is wrong. It's just a matter of time until the blind zeal settles down.

It's only a "silly myth" to idiots like you who never read the research. If you knew anything about molecular genetics you would know that it's the SEQUENCING of functional genes which is compared.

A matter of time? Why don't YOU go into the lab and prove it? Hey I'm sure you can pull together a few geniuses right here on this board to help you out. I'd go for Neo first - a YouTube scientist is always useful idiot to have around.

originally posted by: Phantom423
If you knew anything about molecular genetics you would know that it's the SEQUENCING of functional genes which is compared.

Yes, The real comparison of the chimpanzee and human genomes side by side gave a 82-84% match (source), which does not include the discrepancy of 130,000,000 less base pairs present in humans. your 96%+ is a very deceptive number, delivered like a used car salesmen trying to sell some old junk theory.

Any idea how losing 130,000,000 base pairs from the chimpanzee to the human could result in a bigger and better brain? Nope. Evolution is a junk theory. It did not happen.

a reply to: cooperton

Well, well, well! You finally agree that the Chimp and the human have plenty in common. More/less isn't necessarily better or worse. You made it up again.

But I'll remember what you said - 96% is a deceptive number - in other words, the comparison is real, it's just a different interpretation. Thanks again.

Controversy over.

I think your guy in the sky might agree with you this time around.

a reply to: cooperton

So what did happen, mr appeal to complexity?

With evidence please, and not just your opinion.

If evolution is wrong, you should either be able to correct the error or there should be a testable alternative hypothesis, right?

So extraordinarily, delusionally arrogant of creationists to claim to "know" that god exists... also deceptive because you try to peddle your crap as immutable knowledge.

Creationists are liars and con-artists trying to trick people into sharing their delusion.

originally posted by: Out6of9Balance
a reply to: Akragon

So educated and non-religious is what you highly value. I'm not sure what you think of that to be. It must be good.

English isn't your first language is it...

originally posted by: Phantom423

But I'll remember what you said - 96% is a deceptive number - in other words, the comparison is real, it's just a different interpretation. Thanks again.

The side-by-side comparison found a match of 82-84%. That means approximately 558,000,000 base pairs did not align between the human and chimpanzee genome. That doesn't include the 130,000,000 missing base pairs from chimpanzees to humans. If you don't realize this disproves your theory, then no other words or evidence I use can. Losing 130,000,000 base pairs doesn't transform anything into a human.

"controversy over"

a reply to: cooperton
Note that human dna sequences are added to the raw chimp sequence data just before or during the assembly step for the chimp genome and then the chimp genome is assembled by aligning the short pieces of DNA sequences using the human genome as a framework or guide to determin in which order to assemble or align the pieces consisting of a mixture of chimp and human DNA sequences (one of the reasons to add human DNA sequences, to help with this alignment).

So is it honest to say that one has a chimp genome when it's really a mixture of human and chimp DNA sequences that are assembled by using a human genomic framework for supposed "chimp" sequence assembly and annotation?

Not only is the chimpanzee genome assembly still largely based on the human genomic framework, it is also reported that the wide-spread contamination of non-primate databases with human DNA is a serious problem and can run as high as 10% in some cases. (Longo, M.S. et al., Abundant human DNA contamination identified in non-primate genome databases, PLoS ONE 6(2):e16410, 2011.) The researchers screened 2,749 non-primate public DNA databases from all over the world and reported 492 to be contaminated with human sequence, almost 18%. Human contamination results from the process of cloning DNA fragments in the lab for sequencing where airborne human cells come from coughing, sneezing, and physical contact with contaminated fingers. The detection and characterization of human DNA contamination in primate databases could be a difficult and highly subjective endeavour because of the overriding dogma of primate evolution (how can you tell the difference between human and chimp sequences if you believe they are already almost the same anyway?), nevertheless, the sequencing methods are the same as those used for non-primate databases so one would expect the same type of contamination. It is also noteworthy that the chimpanzee genome was sequenced during the time period where wide-spread human DNA contamination was not well exposed. The contamination problem is also confounded by the use of the human framework for chimp sequence assembly and annotation.

In fact, contamination is not only possible via laboratory error, but is introduced on purpose during chimpanzee genome assembly and annotation based on evolutionary dogma. On a fairly recent (2012) website at the Ensembl database (joint bioinformatics project between EMBL-EBI and the Wellcome Trust Sanger Institute), a webpage titled ‘Chimp Genebuild’ provided the following information as to one of the ways in which the human genome is used as a guide to assemble and annotate the chimp genome:

“Owing to the small number of proteins (many of which aligned in the same location) an additional layer of gene structures was added by projection of human genes. The high-quality annotation of the human genome and the high degree of similarity between the human and chimpanzee genomes enables us to identify genes in chimpanzee by transfer of human genes to the corresponding location in chimp. [Captain subtext says regarding the bolded part: i.e. we added sequence data from human genes to the raw chimp sequence data and now we are pretending that these human genes are actually chimp genes, that we've 'identified' them using this method of deception and spin with word choice. And we are pretending that these sequences from human genes were always a part of the raw chimp sequence data from the start. We'll mention it on a webpage that hardly anybody reads that isn't already sufficiently biased and indoctrinated in favor of evolutionary dogma and our marketing behaviour cause their careers depend on it as well. But not to worry, we'll remove the webpage soon.]

“The protein-coding transcripts of the human gene structures are projected through the WGA [whole genome assembly] onto the chromosomes in the chimp genome. Small insertions/deletions that disrupt the reading-frame of the resultant transcripts are corrected for by inserting ‘frame-shift’ introns into the structure.”

Not only is the chimpanzee genome assembled using the human genome as framework, human sequence contamination is admitted to exist because it was electronically added to fill in generally considered or reputed to be missing chimp sequences (for which no valid evidence is provided that they are "missing", they are not in the raw chimp data and there is no valid reason to suggest that they should be added or were ever there in the first place, so not "missing" in that sense). Based on the myth and dogma that human DNA is supposedly nearly identical to chimp, bits and pieces of human DNA have been fitted into gaps and regions of the chimp genome, making it appear more human. As a result, when downloading the assembled and annotated chimp genome sequence for independent study, the researcher does not have 100% unbiased chimp sequence, as often assumed. Instead, there is a patchwork of human and chimp sequence pieced together, aligned, and oriented based on the human genome.

The chimpanzee genome in its final annotated and assembled state is clearly a biased product. In addition, nearly all research reports on human–chimp DNA similarity omit significant amounts of data that do not align or represent gaps in the sequence. In fact, a significant number of papers do not even include enough data to allow an independent reader the ability to factor in how much original dissimilarity existed before the final, highly filtered numbers are given.

Question: Can any comparison between the human genome with such a chimpanzee genome produce any valid number for DNA similarity?

Given the realities mentioned above, I'm inclined to agree with marine biologist Dr. Robert Carter, who said before 2012:

"That means, that the chimpanzee genome is garbage, it's an embarassment, it should be thrown out and re-done. Cool, you'll never hear that in an evolutionary textbook."

Although he made that statement for slightly different reasons (involving so-called N-blocks, or invented and added* gaps in alignment attempts with the human genome). *: added to the raw chimp data, so for example, if you have a human sequence and chimp sequence as follows:

AAATTTTTCACACTCCTTACAGCT (human)
TTTCGCACGCCTTAACAGCTAAAT (chimp)

Where an honest base for base comparison shows 4 out of 24 bases to be the same, i.e. 16.67% similarity.

You add a gap in front of the raw chimp data that is not present in reality (in the raw data), so you can start your alignment like this for the chimp genome:

-----TTTCG
so that you can then align it with the human:

AAATTTTTCA

Ignoring that the first 5 bases are maybe different (cause the start of my example follows other sequenced bases that I didn't mention), claiming that TTTC is the same, and that a base substitution happened in the past by means of mutation for the last G (chimp) - A (human) difference. And then you count 1 difference for that base substitution and none for the other differences in the raw data. But still counting 1 out of 10 as different in this shorter example, i.e. 90% similarity (9 out of 10). All in an effort of course to better align the rest (which you might notice is more similar if you do this frame-shift, I'm out of comment space to complete my example).

originally posted by: TzarChasm

originally posted by: TzarChasm
The problem here as I see it, is not that the theory of evolution isn't compelling enough. It is that a system of beliefs based on prophecies and medical miracles and other supernatural events can't muster the mind boggling substance that is retold through centuries of incredible literature but simply can't be reproduced in the modern age. It would be so easy to just do a simple performance as a gesture of good will and proof of concept, and there is no risk or cost at all. It would convert millions in a single day. But for some reason, it has not happened. We take that silence as an omen, a fact of reality the same way seeing a dead body is a fact. Absence of evidence is evidence of absence. Surely an earth stopping display of divine authority and unrivaled philanthropic force is exactly what this species needs to persuade us. So what's keeping your god from showing his or her hand and winning the whole debate with literally zero effort? That's my big question.

Still waiting on an actual answer to my big question. Since this is a creationist debate and all.

and still no intelligent response to the idea I submitted as an alternative to this ridiculous carousel of fallacies and ad hominem tactics. i am glad to see I'm not the only one talking about creationist research as a debate tool, should such materials ever see the light of day.

originally posted by: puzzlesphere
a reply to: edmc^2

I did no such thing! I think Dr Venter's research is great!... based on 15 years of evolutionary research... it adds to the already substantial evidence that evolution works. Creationists also pointed to cell "machinery" plus DNA as being inseparable in the past (one of their examples of irreducible complexity)... this research blows that out of the water!

Your point in the OP is invalid because creationists don't produce any research themselves. By not producing any original, testable hypotheses, and only referring to evolution research, creationists put themselves squarely in the evolution court.

You choose to play in the scientific arena (evolution court) by doing nothing but referring to evolutionary research.

You can step outside that court at any time by providing some verifiable creationist research (one of those 200 citations you mentioned?... guess not?) to discuss.

So yes, your OP is invalid.

Cheers

not my words but worth a repost. OP, feel free to present your own evidence for consideration. this is not an "evolution court", all data is worth examining within the scope of scientific methodology and testable/reproducible information.