It looks like you're using an Ad Blocker.

Please white-list or disable AboveTopSecret.com in your ad-blocking tool.

Thank you.

 

Some features of ATS will be disabled while you continue to use an ad-blocker.

 

Strange Mummies From Nazca Studied By Medical Team

page: 33
78
<< 30  31  32    34  35  36 >>

log in

join
share:

posted on Aug, 9 2017 @ 08:05 PM
link   

originally posted by: Heliocentric

originally posted by: Harte

True. It's my opinion based on the facts offered in the thread


Actually, you've chosen to ignore the data presented by the researchers in favor of your preconceived opinion that it must be fake, while favoring the opinions of anonymous persons, calling them facts.


Anonymous persons ? You mean in this forum ? You are also anonymous, so what.
Unless you reveal your real name that is not an argument.




posted on Aug, 9 2017 @ 09:04 PM
link   

originally posted by: free_spirit

Anonymous persons ? You mean in this forum ? You are also anonymous, so what.
Unless you reveal your real name that is not an argument.


It's not about me.

It's about your opinion as an anonymous person lacking credentials or any obvious knowledge on the subject matter vs the professional assessments of MDs with greater credibility than you - in spite of your great efforts to discredit them.



posted on Aug, 9 2017 @ 10:21 PM
link   
a reply to: Heliocentric





Thanks for showing interest, but I don't want to lead the stone throwing kids from here over there.



OK, was just wondering what some of the more sensible theories that have been promulgated.





The DBs are (in the order of the photo) 53cm/20.8', 45.5cm/17.9' and 44cm/17.3' tall. They're tridactyl, with 10 ribs each. No eggs in the stomach, the bumps are something else. More to come on the studies, and I do think more DBs in a near future.



This particular species is relatively small compared to the other long-fingered larger ones. BTW, the Inkari Institute is doing great work here.





It's not about me.

It's about your opinion as an anonymous person lacking credentials or any obvious knowledge on the subject matter vs the professional assessments of MDs with greater credibility than you - in spite of your great efforts to discredit them.



It's funny how these scam-lovers can't recognize that you're telling the whole unfabricated truth about this matter & that they just like to bring up one false accusation after another. If they want the real truth then the data will tell them, and that impartial data is, in the end, the only deciding factor that matters in this case—but they steadfastly refuse to look at that data because they cannot even begin to accept the fact that they may somehow be ultimately wrong.


Great uploads.






posted on Aug, 9 2017 @ 11:50 PM
link   
a reply to: Heliocentric

For it to be slander your true identity would have to be known and you would have to prove damage to your reputation. Since you have remained anonymous throughout this thread how can you prove damage? Additionally, your own contradictions are well documented within the context of this thread so the argument can easily be made you are impeaching yourself.



posted on Aug, 10 2017 @ 11:04 AM
link   

originally posted by: Heliocentric

originally posted by: free_spirit

Anonymous persons ? You mean in this forum ? You are also anonymous, so what.
Unless you reveal your real name that is not an argument.


It's not about me.

It's about your opinion as an anonymous person lacking credentials or any obvious knowledge on the subject matter vs the professional assessments of MDs with greater credibility than you - in spite of your great efforts to discredit them.


So now you're pissed off because I'm an anonymous member of this forum as well as many
other members contributing anonymously, you are anonymous too but: Hey.. listen to this
anonymous reply: " It's not about me ". How convenient Mr. OP, you certainly don't know
how this forum works appealing now to the issue of being anonymous in this forum just
because you are so angry Mr. Anonymous OP. What's wrong with you.

And you claim: " Lacking credentials ". My own research on this hoax and all the evidences
I provided to debunk all the cheaters involved that you invoked, these are my credentials.
I know more of this case Nazca Alien Mummies hoax than you. i have direct sources since
last year when Paul Ronceros went public with the alien tale while you Mr OP were in the
limbo with your friend Thierry Jamin. You know nothing Mr. OP so continue being pissed.

This is turning into a clichè, Mr. OP said: " the professional assessments of MDs "
This sentence alone has no value at all. Who are these MD's, Mr. OP took care not to mention
their names because they have ben debunked, all of them. I challenge you Mr. OP to say the
names of these MD's you' are talking about, let's see who they are and I will reply with my
informations. The fact that this OP is desperate and extremely pissed off with my personal
contributions does not change the course of the case, the downfall of the Nazca Alien Mummies fraud is an indisputable fact.



posted on Aug, 10 2017 @ 11:28 AM
link   

originally posted by: Outlier13
Additionally, your own contradictions are well documented within the context of this thread so the argument can easily be made you are impeaching yourself.


I would like to hear about my contradictions - could you point them out one by one so that I can reflect upon and respond to them more easily?



posted on Aug, 11 2017 @ 08:17 AM
link   
A day later, and the list of my contradictions is either so long it has not been finished yet, or so small I cannot see it.

The web site IRNA - a one woman site who purports to be skeptical to what she calls pseudo-archaeology, specialized in debunking Bosnian pyramids and nitpicking Thierry Jamin - has posted a text by a "geneticist correspondent" treating the DNA result from Paleo DNA.

Apparently both IRNA and the supposed geneticist think the work debunk Thierry Jamin's theories, but I don't think so. Thierry will adapt to wherever the scientific investigation takes us and has said so hundreds of times in the last months.
The text is anonymous but I think it has qualities and should be read by those who are interested in the subject matter.

In any case I think it supports my mention that we should treat Paleo DNAs DNA test with a fair amount of skepticism.

The text is posted in French, I took myself the liberty - in the name of intellectual honesty - to translate it through Google and re-post it. Sorry for the volume of text, but it says a lot:

irna.lautre.net...


1. Interest of mitochondrial DNA in human genetics

1.1. A small haploid genome

The mitochondria is the seat of cellular respiration, one of the metabolic pathways allowing the transformation of glucose into energy. It is a component of all nucleus cells (i.e. eukaryotes), which includes human cells. All the cells of the bacterial world, which lack both nuclei (i.e. prokaryotes) and also mitochondria, and, with rare exception, all other organelles, are opposed to them.

Since the 1960s and the work of Lynn Margulis, it was gradually recognized that mitochondria resulted from the endosymbiosis of a prokaryotic cell in another cell. It is this event that would have given birth to the eukaryotic line.
One of the major arguments is the presence of a small vestigial genome, still autonomously replicated by the mitochondria (16 kbases, compared to the 3900Mbases of the chromosomal human genome). It is indeed a vestige: the functions coded by this autonomous genome are far too few for the mitochondria to be encountered in a free form (the size of a bacterial genome is rather of the order of 1Mb). During evolution, the majority of mitochondrial genes have been integrated into the chromosomal genome.
A single copy of the mitochondrial genome is carried by each individual; This copy is transmitted by the ovule (we speak of matrilineal transmission). It is therefore a haploid genome, which is apparent to that of bacteria. Our chromosomal genome is composed of a copy from each of the two gametes, therefore diploid.

1.2. Preserved markers, others more polymorphic

The structure of the mitochondrial genome is very well known; Due to its small size, its complete sequencing could be carried out since 1981 (it was the Cambridge Reference Sequence, described as its name in Cambridge by Fred Sanger).



Figure: Structure of the human mitochondrial genome. Source

The genes coding for the cytochrome oxidase enzyme subunits (COI, COII, COIII genes), or those coding for cytochrome B (CYB) are relatively conserved from one species to another. For this reason they have therefore frequently been used to compare different species (for example here academic.oup.com...).

Other regions, on the other hand, are hypervariable (HVR1 and 2, HVR for Hyper Variable Region). They accumulate mutations at a much faster pace; They are therefore more amenable to genetic study on a smaller scale, within and across populations.

Once the marker is chosen, it is then necessary to characterize the version that the individuals of the group studied carry. This characteristic is the haplotype of individuals. Individuals with closely related haplotypes form a haplogroup.
Reference: Castresana, J. (2001). "Cytochrome b phylogeny and the taxonomy of great apes and mammals." Molecular Biology and Evolution, 18 (4), 465-471.
1.3. History of human haplotypes

Because of their polymorphism the HVR1 and 2 of the mitochondrial genome have been widely used to understand the relationships between human populations. Thanks to these markers, we can define a small number of haplogroups in our species (en.wikipedia.org...). Their distribution, the frequency of each of these haplogroups varies from one place to another on the planet (for example here the distribution of haplogroup X in Europe: www.eupedia.com... .shtml).


edit on 11-8-2017 by Heliocentric because: (no reason given)



posted on Aug, 11 2017 @ 08:20 AM
link   
It is possible, in parallel, to study the relations of matching between these haplogroups. To simplify, the most similar sequences are more likely to be related (to share the same mutations). We can then construct the most probable ancestral sequence that produced these two relatives (in the same way as in zoology, mammals are defined by breastfeeding behavior, which is probably a characteristic of their common ancestor).

Step by step, one can end up reconstructing the common ancestor of a whole set of haplogroups, as well as their genetic relationships. In the case of human mitochondrial haplogroups this common ancestor was named "Mitochondrial Eve"; Due to the matrilineal transmission of the mitochondrial genome, to go back to the past is to go through the line of mothers.

The updating of this molecular eve, the haplogroup L3, has provided a genetic confirmation of the African origin of man: it is indeed a group mostly encountered among populations originating from Africa 'East.
2. Example: the settlement of the Americas by the Paleoindians

Among other major results, this approach has also cast a new light on the history of the initial (pre-Columbian) settlement of the Americas.

It is now widely acknowledged that the settlement was caused by small human groups from Asia in Alaska through the Bering Strait at a period of glaciation where this crossing was possible on dry foot. This had to occur around -15,000 years ago. There is some uncertainty about the timing of this migration, as the archaeological sites of this period are very rare (Clovis in the United States, around 13,000 years old and Monte Verde in Chile, 15,000 years old).



Figure: History of haplogroup migration across the Bering Strait - Source

Genetics has confirmed this scenario. It revealed that almost all contemporary Amerindians belonged to a small number of indigenous haplogroups, A2, B2, C1, D1 and X2a (cf. Fagundes et al., 2008), declined in a number of sub-haplogroups (Perego Et al (2010) listed 15). Their closest relatives are encountered in Northeast Asia. This argues for a small number of founders of Asian origin.

Different distributions of B and X have suggested distinct assumptions; The later expansion, perhaps around -11000, of haplogroup B2, following the arrival of a new group of migrants through the Bering Strait, or an emergence in North America; For the haplogroup X, an introduction from Europe to prehistoric times.

References :
Brown, M.D., Hosseini, S. H., Torroni, A. Bandelt, H. J., Allen, J.C., Schurr, T. G., & Wallace, D.C. (1998). "MtDNA haplogroup X: an ancient link between Europe / Western Asia and North America? ". The American Journal of Human Genetics, 63 (6), 1852-1861.
- Fagundes, NJ, Kanitz, R., Eckert, R., Valls, AC, Bogo, RM, Salzano, FM, & Santos, SE (2008) A coastal route for the peopling of the Americas. " The American Journal of Human Genetics, 82 (3), 583-592.
- Perego, U. A., Angerhofer, N., Pala, M., Olivieri, A., Lancioni, H., Kashani, B. H., & Zimmermann, B. (2010). "The initial peopling of the Americas: a growing number of mitochondrial genomes from Beringia". Genome Research, 20 (9), 1174-1179.
- Starikovskaya, Y. B., Sukernik, R. I., Schurr, T.G., Kogelnik, A.M., and Wallace, D.C. (1998). "MtDNA diversity in Chukchi and Siberian Eskimos: implications for the genetic history of Ancient Beringia and the peopling of the New World." The American Journal of Human Genetics, 63 (5), 1473-1491.

3. Possible stories of Thierry Jamin's "Main" and "Skull" samples

3.1. Available sequences

Thierry Jamin and his team gave two samples to Paleo-DNA, a resident of Lakehead University in Canada.



posted on Aug, 11 2017 @ 08:22 AM
link   
According to Thierry Jamin, samples are collected on a "hand" and on a "skull", in which several scientists believed to recognize, respectively, a patchwork bone assembly and a fragmentary cat skull. It can also be noted that the "hand" was dated (method C14) by two different laboratories, one giving an age of 7000 years and the other of 1200 years.

These two isolated samples seem to have no link other than their sampling site in southern Peru. The aim of the comparison of these two samples is rather obscure. Paleo-DNA has undertaken to carry out a sequencing of the 16191 -16420 region of human mitochondrial DNA (ie in the terminal part of this genome, which is exactly 16,569 bases). This also corresponds to part of the HVR1 region, ie 190 bases out of 359.

The sequences found by Paleo-DNA were put online by the team of Thierry Jamin:

- 1_crane
ACAGCAANCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACT
AGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACAT
AGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGNGTCCCT
TGAC

- 2_main
TACAGCAATCAACCTTCAACTATCACACATCANCTGCAACTCCAAAGCCACCCCTCACCCACT
AGGATACCAACAAACCTACCCACCCTTAANAGTACATAGTACATAAAGCCATTTACCGTACAT
AGCACATNACAGTCAAATCCCTTCTCGNCCCCATGGATGACCCCCCTCAGATAGGGGTCCCT
TGA
This HVR1 fragment is too short to determine the haplogroup to which the DNA in the samples belongs. Nevertheless, some assumptions can be made on the basis of the results.

Two other sequences (16S and 12S genes) have been attempted, but will not be discussed here: 12S could not be amplified, and 16S is less informative than HVR1 in locating DNA sources.

3.2. "98% Homo sapiens": the problem of ambiguous bases

The Paleo-DNA laboratory aligned the sequences produced from 190 bases using BLASTn, a very popular and rapid tool developed by the NCBI. The NCBI is one of the major American institutes of health (BLASTn online version: blast.ncbi.nlm.nih.gov...). The sequence alignment consists here of comparing with millions of sequences already published and available online. The result is usually given as a percentage: the "best homologue" of a given sequence S, in the state of knowledge at a time t, has a percentage identity X with this sequence S.

Thus, according to the Palaeo-DNA laboratory, BLASTn produced a 99% alignment "with Homo sapiens" for each of the "skull" and "hand" sequences. After verification, it is actually almost 10,000 sequences homologous to 99% ("skull") and 98% ("hand") of identity that can be found, all belonging to Homo sapiens. No homologue is found in another known species.

But this result calls for a nuance. A sequence is normally composed of bases A, T, C, G, but sometimes the sequencer can not determine the precise base, in which case it is an "N" that is filled in.



Figure: illustration of the ambiguous base concept: in this dummy chromatogram, at position 468, two peaks C and T are superposed in the chromatogram. The exact basis can not be determined.

Now, BLASTn does not take into account these so-called ambiguous bases. The sequences generated by the PaleoDNA laboratory include a number of ambiguities (about 2/190 for "skull", 4/190 for "hand", ie 1% and 2% of N). With so many ambiguities, even an alignment of sequences from strictly human samples could only be 99% -98%, at most, with this tool. To explain these ambiguities, the Paleo-DNA laboratory here evokes degraded DNA - which, in fact, must often be encountered in the case of old DNA - but the



posted on Aug, 11 2017 @ 08:23 AM
link   
chromatograms are not visible and other hypotheses can be suggested ( Cf 3.4.1).

It should be noted that in no case, these 98% -99% can not be compared to the percentage of 98% of identity estimated between the homo sapiens and chimpanzee genomes. Indeed, this Man-Chimpanzee comparison (1) was established on DNA encoding (and not on hypervariable regions), (2) with large data sets and not short fragments, (3) And above all, the 2% difference corresponds to real mutations, not inaccuracies in sequencing. To measure what a real mutation in the coding DNA can mean, it is enough to consider the many serious genetic diseases determined by simple point mutations in our genome (i.e. the infamous cystic fibrosis).

By comparison, polymorphism in the small HVR1 region (0.00001% of the human genome!) Has no effect on the development or health status of the individual, and mutations accumulate at a very rapid rate.
3.3. Possible extraterrestrial histories of samples

The previous results give some indication of the nature of the samples. Under the extraterrestrial hypothesis, it should be assumed that the material of origin:

- Contains DNA, or a polymer containing ribose, adenosine, guanine, cytosine, thymine as information medium for the synthesis of biomolecules. This organism from which this material is derived presents a carbon-based chemistry, with a biochemistry based on the triptych lipids / carbohydrates / proteins. The presence of mitochondrial DNA confirms the ability to perform cellular respiration, which involves oxygen requirements. The planet from which this organism is derived thus shares many similarities with the Earth (abundance of carbon, atmosphere with oxygen).

- DNA strongly suggests a molecular machinery identical to ours, with DNA, mRNA, protein synthesis. The search for the HVR1 region, with tools dedicated to human genetics, worked. All possible homologous sequences were found in Homo sapiens.

The organism from which the samples are produced resembles us enormously. All these observations are compatible, a priori, only with two "extraterrestrial" scenarios:

3.3.1. Fortuitous resemblance
 
Somewhere in the Universe, life has appeared in the form of an organism almost identical with H. sapiens. A meeting was held in Peru, hybrids were spawned. We must imagine that the millions of random events that led to the lineage occurred elsewhere, identically, in a deterministic fashion. This contradicts what one knows about life on Earth, where the tree of life resembles more than an intense burst governed by chance. Evolving convergences have been described, but have never generated such "scalable replicates".

3.3.2. Strong Appearance
An extraterrestrial organism has intervened in the course of the evolution of life on Earth, perhaps from the beginning, or perhaps only in interaction with the genus Homo. Continuous genetic exchanges have taken place. The match between Homo sp. And this organization is very high. In Peru there is perhaps a trace of hybridization, or of biotechnology. In this scenario, we can complete the robot portrait of this form of extraterrestrial life: it is very discreet, despite its repeated interactions with the terrestrial living world, and very ancient. If she does biological engineering on a large scale, she is very patient, determined, talented and finally shows a true sense of detail. Because we share even with it HVR1, an extremely short region (0.00001% of the genome) and totally useless from a functional point of view. The intervention is recent and frequent, because this region evolves rapidly; Yet for HVR1 there is as much difference between us and this form of life as between a Peruvian and a Japanese. If there has been hybridization and exchange of genetic material, it is very frequently: no other species intercountening with Homo sapiens is known to date. Decidedly, this form of life loves us very much. "Extra" earthly is actually a great word: after all his efforts, one could almost classify it terrestrial and Homo sapiens, honorificly, and suggest a friendly meeting.

These two scenarios seem so improbable, that one can without remorse to dismiss them in favor of tracks



posted on Aug, 11 2017 @ 08:25 AM
link   
more down to earth ...

3.4. Possible land histories of samples

The following is clearly hypothetical, as the amount of data is very small (two short sequences of 190 bases, with many ambiguities).

To go beyond the alignment by BLASTn, the two generated sequences have been realigned using the CLUSTALW software (included in the versatile MEGA7 software) and analyzed in order to reconstruct the genetic matching relationships under the same software (Distance Tamura and Nei, with the correction parameter gamma = 0.26 suggested for HVR1 by Meyer et al., 1999; construction of the dendrogram by Neighbor Joining).
Reference: Meyer S, Weiss G, von Haeseler A. 1999. "Pattern of nucleotide substitution and rate heterogeneity in the hypervariable regions I and II of human mtDNA". Genetics 152: 1103-1110

Other previously published sequences of known haplogroups have been integrated into the comparison. Particular emphasis has been placed on haplogroup and haplogroup sequences of Amerindians and Paleoindians, in order to optimize our chances of unraveling the links between the DNA sources of the samples and their related probabilities. Other haplogroups encountered in Europe, Asia and Africa were also included in the comparison. All of these sequences are available online through the MitoTool web portal.



Figure: Reconstructed phylogenetic tree including sequences from "skull" and "hand" samples as well as published sequences of known haplogroups (A in red, B light green, C in dark green, D in sky blue and X in violet being The haplogroups encountered among the Amerindians).

Although the alignment is for a fragment of HVR1, the genetic relationships of these different haplogroups and the grouping of the sequences by haplogroup are largely correct. We can compare this tree with what is accepted on the relations of matching between haplogroups on the basis of data sets much more consequent:



Figure: Genetic relationships between human haplogroups - Source

3.4.1. Hand Sample

In comparison with the reference sequence of the alignment, here the sequence "Cambridge Reference Sequence", the sequence has several interesting polymorphic sites (at positions 16223, 16241, 16301, 16342, 16362). In our data, only the haplogroup D4H3a presents this very particular polymorphism (see its description by Kemp et al in 2007). This haplogroup would thus be the best homologue of our sequence.
Reference: Kemp, B. M., Malhi, R.S., McDonough, J., Bolnick, D.A., Eshleman, J.A., Rickards, O., & Fifield, T. E. (2007). "Genetic analysis of early Holocene skeletal remains of Alaska and its implications for the settlement of the Americas." American Journal of Physical Anthropology, 132 (4), 605-621.

The haplogroup D4H3a is specific to the Palaeoindians that populated the Americas around -15,000. It is found mostly in South America following the subsequent expansion of B2 in North America. This haplogroup was therefore encountered in southern Peru at the two dates announced by the carbon 14 datings (7000 and 1200 years). According to the dating, it seems here that we are dealing with a DNA sample from a Paleo- or Amerindian individual, perhaps ancient.
Nevertheless, it should be noted that for all these polymorphic sites - and only those - polymorphism is a sequencing ambiguity. This may not be fortuitous. If the sample contains two separate DNA sources, in equal quantities, belonging to two haplogroups, the sequencing will be ambiguous on all polymorphic sites
edit on 11-8-2017 by Heliocentric because: (no reason given)



posted on Aug, 11 2017 @ 08:27 AM
link   
to distinguish them. This could be an explanation here: one would be in the presence of two sources of DNA, one of haplogroup D4H3a. As for the other, many haplogroups, including Amerindians, could give this result. It could not be identified without a chromatogram.

This two-source hypothesis would explain that two different dates were found in dating. Contamination by multiple sources of DNA is a clear risk to be taken into account when handling old human samples in the field. However, it is not certain that all the precautions were taken by Thierry Jamin and his team. The Paleo-DNA laboratory stipulates that nothing has been provided to it to carry out the necessary checks, which does not support the scientific rigor of the participants of the "Alien Project".

3.4.2. Sample "Skull"

The sequences related to that of the skull sample are of the haplogroup B2, very common among the current Amerindians in Mexico and Central America in particular. Subsequent analyzes, not shown, did reveal that the sequence was branching between the origin of group B, spread throughout Asia, and the Amerindian haplogroups derived from B2. Again, we would have to deal with human material coming from a contemporary Indian or Palaeoindian B2. No dating was performed for this sample.
3.4.3. Conclusion

A DNA-based falsification of living Amerindian individuals is possible here. Just as it is possible that pre-Columbian mummies, more or less ancient, have been sampled and subjected to sequencing. This again raises the question of the destruction of this authentic archaeological material to create a hoax.
edit on 11-8-2017 by Heliocentric because: (no reason given)



posted on Aug, 11 2017 @ 08:59 AM
link   
I thought I'd chip in some more news from Biologist José de la Cruz Lopez Rios, who continues his biological/anatomical studies.



This image shows the positioning of the base of the skull on the smaller DBs in relation to that of a Homo sapiens and a Gorilla. The central part is straight with a reduction towards the occipital region and has a square-shaped foramen magnum , located slightly back of the center.



The second image shows the lower abdomen with legs and horizontal cloaca/ovipositor.
edit on 11-8-2017 by Heliocentric because: (no reason given)



posted on Aug, 11 2017 @ 01:33 PM
link   
I told you a video was coming on the three new DBs, it was put online today. A longer video is in the making:

www.youtube.com...



posted on Aug, 11 2017 @ 03:37 PM
link   
a reply to: Heliocentric

You constantly deflect statements and questions and now you have moved onto making legal accusations. You have zero credibility any longer. Why this thread has not been moved to the HOAX bin is beyond me.



posted on Aug, 11 2017 @ 07:10 PM
link   
Good to see, but he's comparing two real skulls to a cartoon skull.

Isn't that Roger's skull, from "American Dad?"

Harte



posted on Aug, 12 2017 @ 08:06 PM
link   
a reply to: Heliocentric


The post below from scam-lover_14 is my very accurate impersonation of the ones who think this is some kind of money-making scam:





"originally posted by: scam-lover_14


SCAM SCAM SCAM SCAM SCAM SCAM, LOL LOL LOL,
SCAM SCAM SCAM SCAM SCAM SCAM, LOL LOL,
SCAM SCAM SCAM SCAM SCAM SCAM, LOL LOL,
SCAM SCAM SCAM SCAM SCAM SCAM,
LOL LOL.

I am scam-lover_14, and that was my total in-depth analysis & utter
proof that this is a SCAM...LOL LOL LOL LOL, and finally—SCAM!!!!...LOL.

"



I'ts pretty well a 100% perfect match word for word of all those scam accusers out there & their allegations. It's almost mirror-like in its reality—these are exactly the words they say & how they say them every time—it's phenomenal! And the phrases, capitalizations, and tone of desperateness you can hear in each of them are complete clones, it's just so hard to tell this example apart from any of their uploads...it's amazing!


On a serious note—thanks for your DNA work & the video, nearly finished with my work & should be uploading it about Tuesday/Wednesday.






posted on Aug, 13 2017 @ 07:04 AM
link   
I think people should be highly skeptical about this thing, and I think people should try to pick a hole in it and seek out the things that do not make sense - and there are things that do not make sense.

It can be done without preconceived opinions, arrogance, insults and personal attacks though. Using your ego as an explosive vest to destroy anything you don't agree with is a childish way to communicate.

As I've said from the beginning - and I don't have a better answer now than when I started this thread months ago - I don't know what these beings are. I think I'll keep that opinion open for as long as possible.

I know one thing though, ALL the scientific data collected since the studies started in November 2016 indicate that the DBs are authentic, unaltered, real biological entities biomechanically very different but functional that lived in the pre-Columbean era somewhere in the Nazca region.
Not a single one of the researchers in their various domains who have studied the DBs believe in any way or form that this is a hoax or that the DBs are artificial. None of the journalists/investigators who have come so close as to see the DBs and follow the scientific studies believe this is a hoax or that the DBs are artificial. All this can be verified.

I thought I'd link two texts on the subject of possible evolution of highly intelligent dinosaurs (some evolutionists reason that evolution naturally leads towards a higher intelligence as more and more complex organisms develop their survival strategies. Therefore, considering the length of the dinosaur era (170 million years vs 66 million years for the Cenozoic/mammal era) and the high complexity of some species, there should have been very intelligent dinosaurs around). One is rather against, one is more or less for. It seems Richard Dawkins considers it at least a possibility:

scienceblogs.com...

blogs.scientificamerican.com...

This does not mean that I accept the reptilian theory just yet as conceived by Dr. Konstantin Krorotkov, PhD and his team at the University of St Petersburg, Dr. José de Jesus Zalce Benitez, Dr. José de la Cruz Lopez Rios or Dr. Salazar Vivanco (these guys are who they say they are and have not been debunked by anyone, so please show basic respect for their professional opinion even if you have doubts or disagreements). It simply means that if the theory of a reptoid/humanoid creature living (still or up until recently) underground somewhere in Nazca is remotely possible, then so be it.

I don't like the theory. However, as the data rolls in it seems to be heading that way whether I like it or not.

Mario the tomb robber has a short video of the three new DBs. It was put online by Marilyne Helck (a person I know who got Mario's permission to make it public). Mario's fb page has been going on and off and is now probably off. Observe the amount of Diatomaceous earth caked on the bodies as they're fresh out of the tomb. The Diatomaceous earth was later cleaned off to a minimum before analysis.

www.youtube.com...
edit on 13-8-2017 by Heliocentric because: (no reason given)



posted on Aug, 13 2017 @ 07:13 PM
link   
Just putting it out there.

www.thelivingmoon.com...

In a thought experiment published in 1982, paleontologist Dale Russell, curator of vertebrate fossils at the National Museum of Canada in Ottawa, conjectured that, had the Chicxulub meteorite not exterminated the dinosaurs 65 million years ago, bipedal predators (theropods) which existed at that time, such as Troodon, would have evolved into intelligent beings similar in body plan to humans. Troodontids had semi-manipulative fingers, able to grasp and hold objects to a certain degree, and binocular vision. Like most dinosaurs of the troodontid family, this imaginary creature, which Russell called the "Dinosauroid", would have had large eyes and three fingers on each hand, one of which would have been partially opposed. As with most modern reptiles (and birds), its genitalia would have been internal. Russell speculated that it would have required a navel, as a placenta aids the development of a large brain case, however it would not have possessed mammary glands,



posted on Aug, 13 2017 @ 08:11 PM
link   
a reply to: Heliocentric






I think people should be highly skeptical about this thing, and I think people should try to pick a hole in it and seek out the things that do not make sense - and there are things that do not make sense.

It can be done without preconceived opinions, arrogance, insults and personal attacks though. Using your ego as an explosive vest to destroy anything you don't agree with is a childish way to communicate.



If people are honestly skeptical about certain aspects of these mummies then that's perfectly OK. I'd like to have a completely open discussion about any & all possibly questionable facets as long as it's done with a plausible amount of sensible facts—and in a relatively mature and respectful manner.

Nothing is gained without diversity of opinion, and it may well be that someone else's assessment is quintessentially correct, for we must realize that a balanced reasoned argument from both sides is worth it's weight in gold—but to simply disagree just for the sheer sake of it—wastes everyone's valuable time.

Let's hope science does not itself go blind to this very important matter—for if blind science sees no truth—we then, are in blind ignorance left.




I don't like the theory. However, as the data rolls in it seems to be heading that way whether I like it or not.



The circumstances surrounding our ancestry may be something other than we'd ever thought possible—I tend to think of it on the positive side, and that's all that matters.


Thanks again for your valuable input.




new topics

top topics



 
78
<< 30  31  32    34  35  36 >>

log in

join